CRISPRBAC

Submission

1. Target genome of interest

• Select your target genome of interest.
• If there is no match, do select the most closest genome with yours.
• The selection of target genome is important for genome-wide off-target analysis.

2. Paste a sequence

>hilA gene
TGCCACATTTTAATCCTGTTCCTGTATCGAATAAAAAATTCGTCTTTGATGATTTCATAC
TCAACATGGACGGCTCCCTGCTACGCTCAGAAAAGAAAGTCAATATTCCGCCAAAAGAAT
ATGCCGTTCTGGTCATCCTGCTCGAAGCCGCCGGCGAGATTGTGAGTAAAAACACCTTAC
TGGACCAGGTATGGGGCGACGCGGAAGTTAACGAAGAATCTCTTACCCGCTGTATTTATG
CCTTACGACGTATTCTGTCGGAAGATAAAGAGCATCGTTACATTGAAACACTGTACGGAC
AGGGCTATCGGTTTAATCGTCCGGTCGTAGTGGTGTCTCCGCCAGCGCCGCAACCTACGA
CTCATACATTGGCGATACTTCCTTTTCAGATGCAGGATCAGGTTCAATCCGAGAGTCTGC
ATTACTCTATCGTGAAGGGATTATCGCAGTATGCGCCCTTTGGCCTGAGCGTGCTGCCGG
TGACCATTACGAAGAACTGCCGCAGTGTTAAGGATATTCTTGAGCTCATGGATCAATTAC
GCCCCGATTATTATATCTCCGGGCAGATGATACCCGATGGTAATGATAATATTGTACAGA
TTGAGATAGTTCGGGTTAAAGGTTATCACCTGCTGCACCAGGAAAGCATTAAGTTGATAG
AACACCAACCCGCTTCTCTCTTGCAAAACAAAATTGCGAATCTTTTGCTCAGATGTATTC
CCGGACTTCGCTGGGACACAAAGCAGATTAGCGAGCTAAATTCGATTGACAGTACTATGG
TTTACTTACGCGGTAAGCATGAGTTAAATCAATACACCCCCTATAGCTTACAGCAAGCGC
TTAAATTGCTGACTCAATGCGTTAACATGTCGCCAAACAGCATTGCGCCTTACTGTGCGC
TGGCAGAATGCTACCTCAGCATGGCGCAAATGGGGATTTTTGATAAACAAAACGCTATGA
TCAAAGCTAAAGAACATGCGATTAAGGCGACAGAGCTGGACCACAATAATCCACAAGCTT
TAGGATTACTGGGGCTAATTAATACGATTCACTCAGAATACATCGTCGGGAGTTTGCTAT
TCAAACAAGCTAACTTACTTTCGCCCATCTCTGCAGATATTAAATATTATTATGGCTGGA
ATCTCTTCATGGCTGGTCAGTTGGAGGAGGCCTTACAAACGATTAACGAGTGTTTAAAAT
TGGACCCAACGCGTGCAGCCGCAGGGATCACTAAGCTGTGGATTACCTATTATCATACCG
GTATTGATGATGCTATACGTTTAGGCGATGAATTACGCTCACAACACCTACAGGATAATC
CAATATTATTAAGTATGCAGGTTATGTTTCTTTCGCTTAAAGGTAAACATGAACTGGCAC
GAAAATTAACTAAAGAAATATCCACGCAGGAAATTACAGGGCTTATTGCTGTTAATCTTC
TTTATGCTGAATACTGTCAGAATAGCGAGCGTGCCTTACCAACGATAAGAGAATTTCTGG
AAAGTGAACAGCGTATTGATAATAATCCGGGATTATTACCGTTAGTGCTGGTTGCCCACG
GCGAAGCTATTGCCGAGAAAATGTGGAATAAATTTAAAAACGAAGACAATATTTGGTTCA
AAAGATGGAAACAGGATCCCCGCTTGATTAAATTACGGTAA

• Sequence must be in FASTA format.

3. PAM sequence

• PAM (Protospacer Adjacent Motif)
• The choosing of PAM sequence is depending on the Cas9 used in experiment.
• For example, Streptococcus pyogenes Cas9 (SpCas9) recognizes NGG site (N stand for any nucleotide).
• Only NGG site is provided at the moment.

List of bacterial genomes

CRISPRBAC provides a wide range of bacterial species as a template for genome modification such as Salmonella, E. coli and Pseudomonas. Here is a total of 217 bacterial genomes that were kept in our database.

#	Genus	Genome
1	Acinobacter	Acinobacter baumannii str. ACICU (NC_010611)
2	Aeromonas	Aeromonas hydrophila str. ML09-119 (NC_021290)
3		Aeromonas hydrophila subsp. hydrophila str. ATCC 7966 (NC_008570)
4		Aeromonas salmonicida subsp. salmonicida str. A449 (NC_009348)
5		Aeromonas veronii str. B565 (NC_015424)
6	Anaplasma	Anaplasma centrale str. Israel (NC_013532)
7		Anaplasma marginale str. Florida (NC_012026)
8		Anaplasma phagocytophilum str. HZ (NC_007797)
9	Bacillus	Bacillus anthracis str. Ames (NC_003997)
10		Bacillus bacilliformis str. KC583 (NC_008783)
11		Bacillus cereus str. ATCC 14579 (NC_004722)
12		Bacillus cereus str. Q1 (NC_011969)
13		Bacillus clausii str. KSM-K16 (NC_006582)
14		Bacillus halodurans str. C-125 (NC_002570)
15		Bacillus henselae str. Houston-1 (NC_005956)
16		Bacillus licheniformis str. ATCC 14580 (NC_006270)
17		Bacillus quintana str. Toulouse (NC_005955)
18		Bacillus subtilis subsp. subtilis str. 168 (NC_000964)
19		Bacillus thuringiensis serovar konkukian str. 97-27 (NC_005957)
20		Bacillus tribocorum str. CIP 105476 (NC_010161)
21		Bacillus weihenstephanensis str. KBAB4 (NC_010184)
22	Bordetella	Bordetella avium str. 197N (NC_010645)
23		Bordetella bronchiseptica str. RB50 (NC_002927)
24		Bordetella parapertussis str. 12822 (NC_002928)
25		Bordetella pertussis str. Tohama I (NC_002929)
26	Brucella	Brucella abortus bv. 1 str. 9-941 chromosome I (NC_006932)
27		Brucella abortus bv. 1 str. 9-941 chromosome II (NC_006933)
28		Brucella canis str. ATCC 23365 chromosome I (NC_010103)
29		Brucella canis str. ATCC 23365 chromosome II (NC_010104)
30		Brucella melitensis biovar Abortus str. 2308 chromosome I (NC_007618)
31		Brucella melitensis biovar Abortus str. 2308 chromosome II (NC_007624)
32		Brucella melitensis bv. 1 str. 16M chromosome I (NC_003317)
33		Brucella melitensis bv. 1 str. 16M chromosome II (NC_003318)
34		Brucella melitensis str. ATCC 23457 chromosome I (NC_012441)
35		Brucella melitensis str. ATCC 23457 chromosome II (NC_012442)
36		Brucella ovis str. ATCC 25840 chromosome I (NC_009505)
37		Brucella ovis str. ATCC 25840 chromosome II (NC_009504)
38		Brucella suis str. 1330 chromosome I (NC_004310)
39		Brucella suis str. 1330 chromosome II (NC_004311)
40	Burkholderia	Burkholderia cenocepacia str. J2315 chromosome I (NC_011000)
41		Burkholderia cenocepacia str. J2315 chromosome II (NC_011001)
42		Burkholderia cenocepacia str. J2315 chromosome III (NC_011002)
43		Burkholderia mallei str. ATCC 23344 chromosome I (NC_006348)
44		Burkholderia mallei str. ATCC 23344 chromosome II (NC_006349)
45		Burkholderia pseudomallei str. K96243 chromosome I (NC_006350)
46		Burkholderia pseudomallei str. K96243 chromosome II (NC_006351)
47		Burkholderia thailandensis str. E264 chromosome I (NC_007651)
48		Burkholderia thailandensis str. E264 chromosome II (NC_007650)
49	Campylobacter	Campylobacter fetus subsp. fetus str. 82-40 (NC_008599)
50		Campylobacter jejuni str. RM1221 (NC_003912)
51		Campylobacter jejuni subsp. doylei str. 269.97 (NC_009707)
52		Campylobacter jejuni subsp. jejuni str. 81116 (NC_009839)
53	Chlamydia	Chlamydia abortus str. S26/3 (NC_004552)
54		Chlamydia caviae str. GPIC (NC_003361)
55		Chlamydia felis str. Fe/C-56 (NC_007899)
56		Chlamydia muridarum str. Nigg (NC_002620)
57		Chlamydia pneumoniae str. J138 (NC_002491)
58		Chlamydia trachomatis str. 434/Bu (NC_010287)
59		Chlamydia trachomatis str. A/HAR-13 (NC_007429)
60		Chlamydia trachomatis str. D/UW-3/CX (NC_000117)
61		Chlamydia trachomatis str. L2b/UCH-1/proctitis (NC_010280)
62	Clostridium	Clostridium acetobutylicum str. ATCC 824 (NC_003030)
63		Clostridium beijerinckii str. NCIMB 8052 (NC_009617)
64		Clostridium botulinum A str. ATCC 3502 (NC_009495)
65		Clostridium botulinum A2 str. Kyoto (NC_012563)
66		Clostridium botulinum A3 str. Loch Maree (NC_010520)
67		Clostridium botulinum B str. Eklund 17B (NC_010674)
68		Clostridium botulinum B1 str. Okra (NC_010516)
69		Clostridium botulinum E3 str. Alaska E43 (NC_010723)
70		Clostridium botulinum F str. Langeland (NC_009699)
71		Clostridium difficile str. 630 (NC_009089)
72		Clostridium novyi str. NT (NC_008593)
73		Clostridium perfringens str. ATCC 13124 (NC_008261)
74		Clostridium tetani str. E88 (NC_004557)
75		Clostridium thermocellum str. ATCC 27405 (NC_009012)
76	Corynebacterium	Corynebacterium diphtheriae str. NCTC 13129 (NC_002935)
77		Corynebacterium efficiens str. YS-314 (NC_004369)
78		Corynebacterium glutamicum str. ATCC 13032 (NC_003450)
79		Corynebacterium jeikeium str. K411 (NC_007164)
80		Corynebacterium pseudotuberculosis str. FRC41 (NC_014329)
81	Coxiella	Coxiella burnetii str. RSA 493 (NC_002971)
82	Enterococcus	Enterococcus faecalis str. D32 (NC_018221)
83		Enterococcus faecalis str. V583 (NC_004668)
84		Enterococcus faecium str. DO (NC_017960)
85	Escherichia	Escherichia
86		Escherichia coli O104:H4 str. 2009EL-2050 (NC_018650)
87		Escherichia coli O157:H7 str. Sakai (NC_002695)
88		Escherichia coli O25b:H4-ST131 strain:EC958 (NZ_HG941718)
89		Escherichia coli O26:H11 str. 11368 (NC_013361)
90		Escherichia coli O44:H18 str. 042 (NC_017626)
91		Escherichia coli O55:H7 str. RM12579 (NC_017656)
92		Escherichia coli O7:K1 str. CE10 (NC_017646)
93		Escherichia coli O83:H1 str. NRG 857C (NC_017634)
94		Escherichia coli str. 536 (NC_008253)
95		Escherichia coli str. APEC O1 (NC_008563)
96		Escherichia coli str. K-12 substr. MG1655 (NC_000913)
97		Escherichia coli str. SMS-3-5 (NC_011745)
98		Escherichia coli str. UMNK88 (NC_017641)
99		Francisella noatunensis subsp. orientalis str. Toba 04 (NC_017909)
100	Francisella	Francisella philomiragia subsp. philomiragia str. ATCC 25017 (NC_010336)
101		Francisella tularensis subsp. holarctica str. FSC200 (NC_019551)
102		Francisella tularensis subsp. mediasiatica str. FSC147 (NC_010677)
103		Francisella tularensis subsp. tularensis str. SCHU S4 (NC_006570)
104	Haemophilus	Haemophilus ducreyi 35000HP (AE017143.1)
105		Haemophilus influenzae PittEE (CP000671.1)
106		Haemophilus influenzae Rd KW20 (L42023.1)
107		Haemophilus somnus 129PT (CP000436.1)
108	Helicobacter	Helicobacter acinonychis str. Sheeba (AM260522.1)
109		Helicobacter hepaticus ATCC 51449 (AE017125.1)
110		Helicobacter mustelae 12198 (FN555004.1)
111		Helicobacter pylori 26695 (AE000511.1)
112	Klebsiella	Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 (AP006725.1)
113		Klebsiella variicola strain 342 (CP000964.1)
114	Legionella	Legionella longbeachae NSW150 (FN650140.1)
115		Legionella pneumophila subsp. pneumophila str. Philadelphia 1 (AE017354.1)
116	Listeria	Listeria innocua Clip11262 (AL592022.1)
117		Listeria ivanovii subsp. ivanovii PAM 55 (NC_016011.1)
118		Listeria monocytogenes EGD-e (AL591824.1)
119		Listeria monocytogenes serotype 7 str. SLCC2482 (FR720325.1)
120		Listeria monocytogenes str. 4b F2365 (AE017262.2)
121		Listeria monocytogenes strain SLCC2372, serotype 1/2c (FR733648.1)
122		Listeria monocytogenes strain SLCC2755, serotype 1/2b (FR733646.1)
123		Listeria seeligeri serovar 1/2b str. SLCC3954 (FN557490.1)
124		Listeria welshimeri serovar 6b str. SLCC5334 (AM263198.1)
125	Mycobacterium	Mycobacterium abscessus subsp. massiliense str. GO 06 (CP003699.2)
126		Mycobacterium africanum GM041182 (FR878060.1)
127		Mycobacterium avium subsp. paratuberculosis str. k10 (AE016958.1)
128		Mycobacterium bovis BCG str. Mexico (CP002095.1)
129		Mycobacterium canettii CIPT 140060008 (FO203507.1)
130		Mycobacterium gilvum Spyr1 (CP002385.1)
131		Mycobacterium indicus pranii MTCC 9506 (CP002275.1)
132		Mycobacterium tuberculosis H37Rv (AL123456.3)
133		Mycobacterium ulcerans Agy99 (CP000325.1)
134	Mycoplasma	Mycoplasma agalactiae PG2 (CU179680.1)
135		Mycoplasma arthritidis 158L3-1 (CP001047.1)
136		Mycoplasma capricolum subsp. capricolum ATCC 27343 (CP000123.1)
137		Mycoplasma conjunctivae HRC/581T (NC_012806.1)
138		Mycoplasma fermentans JER (CP001995.1)
139		Mycoplasma gallisepticum str. R(low) (AE015450.2)
140		Mycoplasma genitalium G37 (L43967.2)
141		Mycoplasma hominis ATCC 23114 (FP236530.1)
142		Mycoplasma hyopneumoniae 232 (AE017332.1)
143		Mycoplasma mobile 163K (AE017308.1)
144		Mycoplasma mycoides subsp. mycoides SC str. PG1 (BX293980.2)
145		Mycoplasma penetrans HF-2 DNA (BA000026.2)
146		Mycoplasma pneumoniae M129 (U00089.2)
147		Mycoplasma pulmonis UAB CTIP (AL445566.1)
148		Mycoplasma synoviae 53 (AE017245.1)
149	Neisseria	Neisseria gonorrhoeae NCCP11945 (CP001050.1)
150		Neisseria lactamica 020-06 (FN995097.1)
151		Neisseria meningitidis MC58 (AE002098.2)
152	Pseudomonas	Pseudomonas aeruginosa PAO1 (AE004091.2)
153		Pseudomonas entomophila str. L48 (CT573326.1)
154		Pseudomonas fluorescens SBW25 (AM181176.4)
155		Pseudomonas mendocina ymp (CP000680.1)
156		Pseudomonas putida KT2440 (AE015451.2)
157		Pseudomonas savastanoi pv. phaseolicola 1448A (NC_005773.3)
158		Pseudomonas stutzeri A1501 (CP000304.1)
159	Rickettsia	Rickettsia africae ESF-5 (CP001612.1)
160		Rickettsia akari str. Hartford (CP000847.1)
161		Rickettsia bellii OSU 85-389 (CP000849.1)
162		Rickettsia canadensis str. McKiel (CP000409.1)
163		Rickettsia conorii str. Malish 7 (AE006914.1)
164		Rickettsia massiliae MTU5 (CP000683.1)
165		Rickettsia peacockii str. Rustic (CP001227.1)
166		Rickettsia prowazekii str. Madrid E (AJ235269.1)
167		Rickettsia rickettsii str. Iowa (CP000766.3)
168		Rickettsia typhi str. Wilmington (AE017197.1)
169	Salmonella	Salmonella enterica subsp. arizonae serovar 62:z4,z23:-- (NC_010067.1)
169		Salmonella enterica subsp. enterica serovar Agona str. SL483 (CP001138.1)
170		Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 (AE017220.1)
171		Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 (CP001144.1)
172		Salmonella enterica subsp. enterica serovar Enteritidis str. P125109 (AM933172.1)
173		Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91 (AM933173.1)
174		Salmonella enterica subsp. enterica serovar Heidelberg str. SL476 (CP001120.1)
175		Salmonella enterica subsp. enterica serovar Newport str. SL254 (CP001113.1)
176		Salmonella enterica subsp. enterica serovar Paratyphi A str. AKU_12601 (FM200053.1)
177		Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150 (CP000026.1)
178		Salmonella enterica subsp. enterica serovar Paratyphi B str. SPB7 (CP000886.1)
179		Salmonella enterica subsp. enterica serovar Paratyphi C strain RKS4594 (NC_012125.1)
180		Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633 (CP001127.1)
181		Salmonella enterica subsp. enterica serovar Typhi str. CT18 (AL513382.1)
182		Salmonella enterica subsp. enterica serovar Typhi Ty2 (AE014613.1)
183		Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 (AE006468.2)
184	Shigella	Shigella boydii Sb227 (CP000036.1)
185		Shigella dysenteriae Sd197 (CP000034.1)
186		Shigella flexneri 2a str. 2457T (AE014073.1)
187		Shigella flexneri 5 str. 8401 (CP000266.1)
188		Shigella sonnei Ss046 (CP000038.1)
189	Staphylococcus	Staphylococcus aureus RF122 (AJ938182.1)
190		Staphylococcus aureus subsp. aureus Mu3 (AP009324.1)
191		Staphylococcus aureus subsp. aureus Mu50 (BA000017.4)
192		Staphylococcus epidermidis RP62A (CP000029.1)
193		Staphylococcus haemolyticus JCSC1435 (AP006716.1)
194		Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 (AP008934.1)
195	Streptococcus	Streptococcus agalactiae A909 (CP000114.1)
196		Streptococcus dysgalactiae subsp. equisimilis GGS_124 (AP010935.1)
197		Streptococcus equi subsp. equi 4047 (FM204883.1)
198		Streptococcus equi subsp. zooepidemicus MGCS10565 (CP001129.1)
199		Streptococcus gordonii str. Challis substr. CH1 (CP000725.1)
200		Streptococcus mutans NN2025 (AP010655.1)
201		Streptococcus pneumoniae R6 (AE007317.1)
202		Streptococcus pyogenes MGAS5005 (CP000017.2)
203		Streptococcus sanguinis SK36 (CP000387.1)
204		Streptococcus suis 05ZYH33 (CP000407.1)
205		Streptococcus thermophilus LMD-9 (CP000419.1)
206	Vibrio	Vibrio cholerae O1 biovar eltor str. N16961 chromosome I (AE003852.1)
207		Vibrio cholerae O1 biovar eltor str. N16961 chromosome II (AE003853.1)
208		Vibrio fischeri ES114 chromosome I (CP000020.2)
209		Vibrio fischeri ES114 chromosome II (CP000021.2)
210		Vibrio parahaemolyticus RIMD 2210633 (BA000031.2)
211		Vibrio parahaemolyticus RIMD 2210633 (BA000032.2)
212		Vibrio vulnificus CMCP6 chromosome I (AE016795.3)
213		Vibrio vulnificus CMCP6 chromosome II (AE016796.2)
214	Yersinia	Yersinia enterocolitica subsp. enterocolitica 8081 (AM286415.1)
215		Yersinia enterocolitica subsp. palearctica 105.5R(r) (NC_015224.1)
216		Yersinia pestis biovar Microtus str. 91001 (AE017042.1)
217		Yersinia pseudotuberculosis IP 31758 (CP000720.1)

On-target activity scoring

On-target is the ability of gRNA to successfully find and bind Cas9 to the target sequence (Mendoza & Trinh, 2018). On-target activity is scored based on physical and sequence features of gRNA such as GC content, minimum free energy (MFE), melting temperature (Tm), position-specific nucleotide and non-specific position nucleotide. Of 479 features, we used Random Forest to select important features by comparing 5-fold cross-validation results of top 50, 100, 150, 200, 250, 300, 350, 400 and 479 features. The features were then ranked based on the mean decrease impurity (Gini importance). We found that the top 150 features have higher accuracy of predicted model (Accuracy = 0.7316). Then, we used Logistic Regression coefficient to obtain model weight for each feature (Accuracy = 0.7353). This model weight will be further used to compute on-target scoring.

On-target activity is scored as below:

where g(sj):

• int (intercept) = 0.0412385
• wij = weight of feature i

The score is ranged from 0 to 1. Higher score indicates higher predicted on-target activity.

Off-target scoring

Off-target is the probabilty of gRNA sequence bind to a non-matching sequence in the genome (Mendoza & Trinh, 2018). Our off-target score use CFD (Cutting Frequency Determination) score generated by Doench et. al., (2016) to predict off-target activity of gRNAs. For more details, please refer to their publication.

The score is ranged from 0 to 1. Higher score indicates higher off-target activity (Note: Best gRNA would have lower off-target score).

Interpreting results

Overview results:

Items	Description
gRNA sequence	20-nucleotide sequence with PAM (highlighted).
Position	Position of gRNA in selected target genome.
GC_20nt	GC content of entire gRNA sequence.
GC_seed	GC content of seed region (10th to 20th bases).
Tm_20nt	Melting temperature of entire gRNA sequence.
Tm_seed	Melting temperature of seed region.
On-target	On-target score reflecting efficiecy of gRNA to find and bind to the target sequence. Higher on-target score indicates higher efficiency of gRNA. Best gRNA would have higher on-target score.
Off-target	Number of regions found in target genome that have at most 7 mismatches against gRNA sequence. Click for more details on off-target.

Off-target prediction table:

Items	Description
Off-target	20-nucleotide off-target sequence with PAM (highlighted).
Mismatches	Number of mismatches.
Start	Start position of off-target in target genome.
End	End position of off-target in target genome.
CFD score	CFD score reflecting the probabilty of Cas9 would bind to the non-target sequence. Higher score indicates higher off-target activity. Best gRNA would have lower CFD score.

References

Mendoza, B. J., & Trinh, C. T. (2018). Enhanced guide-RNA design and targeting analysis for precise CRISPR genome editing of single and consortia of industrially relevant and non-model organisms. Bioinformatics, 34(1), 16-23.

Doench, J. G., Fusi, N., Sullender, M., Hegde, M., Vaimberg, E. W., Donovan, K. F., ... & Virgin, H. W. (2016). Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nature biotechnology, 34(2), 184.

CRISPRBac